Rheumatoid arthritis (RA) is characterized as a systemic auto immune disorder linked to a persistent inflammatory process that can harm both joints and extra articular organs.
The upregulation of the CCR6/CCL20 axis in the synovial tissues and salivary glands (in cases of secondary Sjögren's syndrome) is considered to contribute to the recruitment of Th17 cells, which in turn enhances IL 17A production and promotes the inflammatory cycle.
Adults (18-60 years) diagnosed with RA according to the American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) 2010 classification criteria for RA by an expert rheumatologist.
• Patients with co-existing infections or other autoimmune diseases.
Patients with Rheumatoid Arthritis aged from 18 years to 60 years, in Rheumatology and Rehabilitation department of Sohag University Hospital and healthy controls of matched age and sex
Case-control
Cross-sectional
Gene expression by quantitative Real Time PCR
GeneticSample collection: * 5 ml peripheral blood will be collected under sterile conditions. 1-Gene Expression Assay * Total RNA Extraction * cDNA Synthesis * Gene Expression Analysis: o Quantitative Real-Time PCR (qRT-PCR) for CCR6 gene expression using primer as follows: Forward primer (5'-3'): CCACAATGAGCGGGGAATCAATGAA Reverse primer (5'-3'): CAAATAGCCTGGAGAACTGCCTGAC * Normalization using housekeeping gene (GAPDH) Forward primer (5'-3'): GAAACCTGCCAAGTATGATG Reverse primer (5'-3'): AGGAAATGAGCTTGACAAAG 2-Assesment of CCL20 plasma level * Using Enzyme Linked Immunosorbent Assay kit (ELISA).
assess expression of CCR6 gene in peripheral blood leukocytes of RA patients compared to healthy individuals
assessment of CCR6 gene expression level using quantitative real time PCR
Measure the plasma levels of CCL20
Measurement of the plasma levels of CCL20 using enzyme-linked immunosorbent assay (ELISA)
Click on the lead sponsor to view all of their trials.
This trial is not recruiting at the moment. You can still explore other options:
